| 產(chǎn)品名稱 |
Der p1 - clone 3e |
| 商品貨號(hào) |
B207191 |
| Designations |
Der p1 - clone 3e |
| GenBank Number |
S66377
|
| Species |
Dermatophagoides pteronyssinus, house dust mite (HDM) |
| Depositors |
NA Kalsheker |
| Applications |
contains sequence cysteine protease |
| Vector |
Construct size (kb): 3.349999904632568 DESCRIPTION OF VECTOR COMPONENT: Name of vector: pUC18 Intact vector size: 2.686 Type of vector: plasmid Vector end: BamHI Vector end: XbaI Cloning sites: HindIII SphI PstI SalI AccI HincII XbaI BamHI SmaI KpnI SacI EcoRI Polylinker sites: HindIII SphI PstI SalI AccI HincII XbaI BamHI SmaI KpnI SacI EcoRI Construction: pUC71K Host range: Escherichia coli Features (with orientation and position when available): insert detection: lacZ', <- MCS: HindIII...EcoRI, -> promoter: lac, <- replicon: pMB1, <- marker(s): ampR, <- Cross references: DNA Seq. Acc.: L08752 |
| Insert |
DNA: cDNA DESCRIPTION OF INSERT COMPONENT: Genome: house dust mite (HDM) Gene symbol: Der p1 Gene name: cysteine protease Contains complete coding sequence?: U Type of DNA: cDNA Insert end: Modification: BamHI linker Insert end: Modification: XbaI linker Insert size (kb): 0.7 Cross references: DNA Seq. Acc.: S66377 Nucleotides 21-686 of the insert correspond to nucleotides ~344-1009 of S66377. Insert lengths(kb): 0.699999988079071 Gene product: cysteine protease [Der p1] Target Gene: cysteine protease |
| Insert Size (kb) |
0.700 |
| Media |
ATCC® Medium 1227: LB Medium (ATCC medium 1065) with 50 mcg/ml ampicillin
|
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Shipping Information |
Distributed: freeze-dried |
| Comments |
Restriction digests of the clone give the following sizes (kb): BamHI/XbaI--2.7, 0.7; HindIII--3.0, 0.35; PvuII--2.3, 0.75, 0.3. Insert contains the following restriction sites (approximate kb from the 5' end): ClaI--0.06, 0.30, 0.64; HindIII--0.41; NdeI--0.67; PstI--0.03; PvuII--0.05. Insert contains the complete coding sequence for the mature peptide plus the following 20 bp sequence at the 5' end: 5' - CTAATGTGATTTCCAAGCGC - 3'. |
| References |
Scobie G, et al. Expression cloning of a dust mite cysteine proteinase, Der p1, a major allergen associated with asthma and hypersensitivity reactions. Biochem. Soc. Trans. 22: 448S, 1994. PubMed: 7698465
Chua KY, et al. Sequence polymorphisms of cDNA clones encoding the mite allergen Der p I. Int. Arch. Allergy Immunol. 101: 364-368, 1993. PubMed: 8353459
Noor A Kalsheker, personal communication
|